Veicoli - Giuseppe de Micheli

Sezione dedicata agli incipit di LTL5

Moderatori: dixit, daniele missiroli

Messaggi: 3
Iscritto il: 14/03/2013, 22:33

Veicoli - Giuseppe de Micheli

Messaggio da leggere da Giuseppazzo » 15/03/2013, 10:16

Abbiamo viaggiato per milioni di anni nella galassia, chiusi nelle polveri stellari, alla ricerca di mondi adatti; ne abbiamo trovato uno altamente competitivo e, nonostante tutto, siamo sopravvissuti.
‒ Riconosce questo DNA? ‒ Lo sguardo del Pubblico Ministero era minaccioso mentre sottoponeva all'imputato il tracciato di un genoma.

Questo è l'incipit. Si capisce già chi sono i viaggiatori?

Avatar utente
Marco Signorelli
Messaggi: 1770
Iscritto il: 21/10/2010, 10:03

Re: Veicoli - Giuseppe de Micheli

Messaggio da leggere da Marco Signorelli » 15/03/2013, 10:45

Inizio da giallo; però sfido chiunque a riconoscere un DNA solo guardando la catena o la sequenza. GCATTAGCCAAATTCATGGATCATCG e così per 3 miliardi di coppie di basi.
Ultima modifica di Marco Signorelli il 15/03/2013, 12:29, modificato 1 volta in totale.

Avatar utente
Messaggi: 18
Iscritto il: 09/03/2013, 16:01

Re: Veicoli - Giuseppe de Micheli

Messaggio da leggere da Rovignon » 15/03/2013, 12:21

Perchè no? basta che poi arrivi una spiegazione "credibile"! ;)

Avatar utente
Massimo Baglione
Messaggi: 7356
Iscritto il: 22/09/2006, 8:12
Località: aznediseR

Re: Veicoli - Giuseppe de Micheli

Messaggio da leggere da Massimo Baglione » 15/03/2013, 21:04

Sembrerebbero virus, ma siccome chiacchierano mi pare strano.

Immagine <<< io sono nel Club dei Recensori di


Avatar utente
Messaggi: 300
Iscritto il: 15/06/2012, 15:54
Località: Parma

Re: Veicoli - Giuseppe de Micheli

Messaggio da leggere da Pardan » 16/03/2013, 0:18

Effettivamente riconoscere a vista un DNA mi sembra difficile, vedremo come va a finire :-)

Avatar utente
Messaggi: 1124
Iscritto il: 18/01/2012, 10:59
Località: Modena

Re: Veicoli - Giuseppe de Micheli

Messaggio da leggere da OvoNuovo » 16/03/2013, 10:38

Non sono d'accordo, se il DNA appartiene a un tuo parente che sei stato obbligato a frequentare per anni, ma che poi sei riuscito a evitare secondo lo riconosceresti anche solo dall'odore! :D

Intrigante contaminazione tra giallo e fantascienza, gli esseri nascosti che hanno viaggiato per anni di cosa saranno responsabili?

Messaggi: 83
Iscritto il: 12/06/2012, 1:23

Re: Veicoli - Giuseppe de Micheli

Messaggio da leggere da 451 » 16/03/2013, 18:39

sgamato, i viaggiatori sono i magistrati del CSM banditi dall'Italia e condannati a vivere nello spazio aperto, evolutisi fino a scoprire dal DNA la colpevolezza degli inquisiti... :O

Avatar utente
Messaggi: 1124
Iscritto il: 18/01/2012, 10:59
Località: Modena

Re: Veicoli - Giuseppe de Micheli

Messaggio da leggere da OvoNuovo » 17/03/2013, 19:07

451 ha scritto:sgamato, i viaggiatori sono i magistrati del CSM banditi dall'Italia e condannati a vivere nello spazio aperto, evolutisi fino a scoprire dal DNA la colpevolezza degli inquisiti... :O
Le so... tutte.
